View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5983_low_13 (Length: 215)
Name: NF5983_low_13
Description: NF5983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5983_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 31475524 - 31475328
Alignment:
| Q |
1 |
aataaaatgaccttagattatgatttatgagaaactgatgagaagtatagatttcacattgtttgcattacacaaccaataaaatgacctcaaattactt |
100 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31475524 |
aataaaatgaccttatattatgatttatgagaaaccgatgagaaatatagatttcacattgtttgcattacacaaccaataaaatgacctcaaattactt |
31475425 |
T |
 |
| Q |
101 |
atggtgagaataaggacttctttcacttggaataagcacagataataaaattagatttaaagtttctttta-cgtggtacataatatttatgtccaaac |
198 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
31475424 |
atggt--gaataaggacttctttcacttggaataagcacaaataataaaattagatttaaagtttctttcagcgtggtacataatatttatgtccaaac |
31475328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 114 - 146
Target Start/End: Complemental strand, 31477341 - 31477309
Alignment:
| Q |
114 |
ggacttctttcacttggaataagcacagataat |
146 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
31477341 |
ggacttctttcacttggaataagcacaaataat |
31477309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University