View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5984_high_12 (Length: 329)
Name: NF5984_high_12
Description: NF5984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5984_high_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 19 - 304
Target Start/End: Original strand, 12683529 - 12683814
Alignment:
| Q |
19 |
acaggtgccaccagcagccggggcggatgtgaccatggaggaagctgagactgagaatgatcagccgcgtcgagatgaagaagaatattatgacgatgat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12683529 |
acaggtgccaccagcagccggggcggatgtgaccatggaggaagctgagactgagaatgatcggccgcatcgagatgaagaagaatattatgacgatgat |
12683628 |
T |
|
| Q |
119 |
gacggtgatgatgacgaggacgaagacgaaggtattgacaattatgaagtggttgccaacaaaccaccgccacctcaatgaaaataatgattgtaattaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12683629 |
gacggtgatgatgacgaggacgaagacgaaggtattgacaattatgaagtggttgccaacaaaccaccgccacctcaatgaaaataatgattgtaattaa |
12683728 |
T |
|
| Q |
219 |
tcattgaatgaggctctaggtaggggctaaaagagtgcatggactgttgtaaaaagtggcagtaagcggcggcaactacaccggca |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12683729 |
tcattgaatgaggctctaggtaggggctaaaagagtgcatggactgttgtaaaaagtggcagtaagcggcggcaactacaccggca |
12683814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University