View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5984_high_14 (Length: 294)

Name: NF5984_high_14
Description: NF5984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5984_high_14
NF5984_high_14
[»] chr5 (3 HSPs)
chr5 (184-286)||(14891631-14891733)
chr5 (196-283)||(14873113-14873200)
chr5 (67-114)||(14891519-14891566)


Alignment Details
Target: chr5 (Bit Score: 99; Significance: 7e-49; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 184 - 286
Target Start/End: Original strand, 14891631 - 14891733
Alignment:
184 tatgatggttgtattttaggtttccggtgcaattggctggtacacaggtctcattgacgccgttgcatggtgtcactgcttctgcattgttcacttctct 283  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
14891631 tatgatggttgtattttaggtttccggtgcaattggctggtacacaggtctcattgacgccgttgcatagtgtcactgcttctgcattgttcacttctct 14891730  T
284 gct 286  Q
    |||    
14891731 gct 14891733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 196 - 283
Target Start/End: Original strand, 14873113 - 14873200
Alignment:
196 attttaggtttccggtgcaattggctggtacacaggtctcattgacgccgttgcatggtgtcactgcttctgcattgttcacttctct 283  Q
    |||||||||| |||||||| || |||||||||||||| |||||||| || |||||| ||||||||||||||||||| |||||||||||    
14873113 attttaggttaccggtgcagttagctggtacacaggtatcattgacaccattgcatagtgtcactgcttctgcattattcacttctct 14873200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 67 - 114
Target Start/End: Original strand, 14891519 - 14891566
Alignment:
67 aagcttccccacaaaaacgctcactctcctactccataaggtaaatca 114  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||    
14891519 aagcttccccacaaaaacgcttactctcctactccataaggtaaatca 14891566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University