View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5984_high_7 (Length: 528)
Name: NF5984_high_7
Description: NF5984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5984_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 458; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 458; E-Value: 0
Query Start/End: Original strand, 19 - 520
Target Start/End: Original strand, 31228347 - 31228851
Alignment:
| Q |
19 |
ctttttgtttttatgatgcaagcaaaatcaagtcatttcagtaatcaaagtatgggtaatacaattcagtgcatgaaactgtgtgaggagcgta--agat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |
|
|
| T |
31228347 |
ctttttgtttttatgatgcaagcaaaatcaagtcatttcagtaatcaaagtatgggtaatacaattcagtgcatgaaactgtgtgaggagcatataagat |
31228446 |
T |
 |
| Q |
117 |
agagaagcttgtgttgagagtgtgaactctactatttgcttgttgcctaggatcaaaccgtataccaaactgttgtgaatttctttgtca-cgtcatgca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31228447 |
agagaagcttgtgttgagagtgtgaactctactatttgcttgttgcctaggatcaaaccgtataccaaactgttgtgaatttctttgtcagcgtcatgca |
31228546 |
T |
 |
| Q |
216 |
cgacttgtttgctattcatctcgaaaatcacattttgcaatcccgccgattctatccatgccattgattgaattaaagctcaagcttcaccttcagctac |
315 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
31228547 |
cgacctgtttgctattcatctcgaaaatcacattttgcagtcccaccgattctatccatgccattgcttgaattaaacctcaagcttcaccttcagctac |
31228646 |
T |
 |
| Q |
316 |
acgctcgcggagcaccaatttgttttggctacaatgaatttaccatagtcatcccttgcacacatgccaacacataaacactgctcatccgcaaaaaatg |
415 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31228647 |
acgctcgcggagcaccaatttgttttggctacaatgaatttaccatagtcatcccttgcacacatgccaacacataaacactgctcatccgcaaaaaatg |
31228746 |
T |
 |
| Q |
416 |
cagcatccagactgcattttacataactggtaggtagaggtatccaattttctgtcatgcgaacttctggctggtctgctccagctgatacacgctgcct |
515 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31228747 |
cagcatccagactgcattttacataactggtaggtagaggtatccaattttctgtcatgcgaacttctggctggtctgctccagctgatacacgctgcct |
31228846 |
T |
 |
| Q |
516 |
atgct |
520 |
Q |
| |
|
|||| |
|
|
| T |
31228847 |
gtgct |
31228851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University