View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5984_low_11 (Length: 353)
Name: NF5984_low_11
Description: NF5984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5984_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 15 - 338
Target Start/End: Original strand, 38484058 - 38484381
Alignment:
| Q |
15 |
tatcgttgctgcagggtgggtcgttgttttttcttacttttatacgaagacatggaagcagagaaaccacgacaaagaatggtctgttgaagctaataag |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38484058 |
tatcgttgctgcagggtgggtcgttgttttttcttacttttatacgaagacatggaagcagagaaaccacgacaaagaatggtctgttgaagctaataag |
38484157 |
T |
|
| Q |
115 |
aggttgataatttttcttaaagtttgttttctttttgttattccggagcttattgctttggcactttttatactaccttggattagaaattttatggaga |
214 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38484158 |
aggttgatagtttttcttaaagtttgttttctttttgttattccggagcttattgctttggcactttttatactaccttggattagaaattttatggaga |
38484257 |
T |
|
| Q |
215 |
aaagaaattggaggattatttatatgttcacatggtggtttcagaggagaatttatgttggtcgtggattgagacaaggtcttgtagatagtgttaagta |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
38484258 |
aaagaaattggaggattatttatatgttcacatggtggtttcagaggagaatttacgttggtcgtggattgagacaaggtcttgtagatagtgttaaata |
38484357 |
T |
|
| Q |
315 |
tactttgttttgggttgtggtgtt |
338 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
38484358 |
tactttgttttgggttgtggtgtt |
38484381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 154 - 293
Target Start/End: Original strand, 30118596 - 30118735
Alignment:
| Q |
154 |
attccggagcttattgctttggcactttttatactaccttggattagaaattttatggagaaaagaaattggaggattatttatatgttcacatggtggt |
253 |
Q |
| |
|
||||||||| || | ||||| || || |||||||| |||||||||||||| ||| ||||||| | ||| |||||||| |||| ||| | | ||||||| |
|
|
| T |
30118596 |
attccggaggttctggctttagccctgtttatacttccttggattagaaactttgtggagaatacaaactggaggatcttttacatgctgtcgtggtggt |
30118695 |
T |
|
| Q |
254 |
ttcagaggagaatttatgttggtcgtggattgagacaagg |
293 |
Q |
| |
|
||||||| |||| | ||||||||| || |||||| |||| |
|
|
| T |
30118696 |
ttcagagcagaagctttgttggtcggggtttgagagaagg |
30118735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University