View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5984_low_12 (Length: 329)

Name: NF5984_low_12
Description: NF5984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5984_low_12
NF5984_low_12
[»] chr6 (1 HSPs)
chr6 (19-304)||(12683529-12683814)


Alignment Details
Target: chr6 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 19 - 304
Target Start/End: Original strand, 12683529 - 12683814
Alignment:
19 acaggtgccaccagcagccggggcggatgtgaccatggaggaagctgagactgagaatgatcagccgcgtcgagatgaagaagaatattatgacgatgat 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||    
12683529 acaggtgccaccagcagccggggcggatgtgaccatggaggaagctgagactgagaatgatcggccgcatcgagatgaagaagaatattatgacgatgat 12683628  T
119 gacggtgatgatgacgaggacgaagacgaaggtattgacaattatgaagtggttgccaacaaaccaccgccacctcaatgaaaataatgattgtaattaa 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12683629 gacggtgatgatgacgaggacgaagacgaaggtattgacaattatgaagtggttgccaacaaaccaccgccacctcaatgaaaataatgattgtaattaa 12683728  T
219 tcattgaatgaggctctaggtaggggctaaaagagtgcatggactgttgtaaaaagtggcagtaagcggcggcaactacaccggca 304  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12683729 tcattgaatgaggctctaggtaggggctaaaagagtgcatggactgttgtaaaaagtggcagtaagcggcggcaactacaccggca 12683814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University