View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5984_low_14 (Length: 294)
Name: NF5984_low_14
Description: NF5984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5984_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 99; Significance: 7e-49; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 184 - 286
Target Start/End: Original strand, 14891631 - 14891733
Alignment:
| Q |
184 |
tatgatggttgtattttaggtttccggtgcaattggctggtacacaggtctcattgacgccgttgcatggtgtcactgcttctgcattgttcacttctct |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
14891631 |
tatgatggttgtattttaggtttccggtgcaattggctggtacacaggtctcattgacgccgttgcatagtgtcactgcttctgcattgttcacttctct |
14891730 |
T |
 |
| Q |
284 |
gct |
286 |
Q |
| |
|
||| |
|
|
| T |
14891731 |
gct |
14891733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 196 - 283
Target Start/End: Original strand, 14873113 - 14873200
Alignment:
| Q |
196 |
attttaggtttccggtgcaattggctggtacacaggtctcattgacgccgttgcatggtgtcactgcttctgcattgttcacttctct |
283 |
Q |
| |
|
|||||||||| |||||||| || |||||||||||||| |||||||| || |||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
14873113 |
attttaggttaccggtgcagttagctggtacacaggtatcattgacaccattgcatagtgtcactgcttctgcattattcacttctct |
14873200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 67 - 114
Target Start/End: Original strand, 14891519 - 14891566
Alignment:
| Q |
67 |
aagcttccccacaaaaacgctcactctcctactccataaggtaaatca |
114 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14891519 |
aagcttccccacaaaaacgcttactctcctactccataaggtaaatca |
14891566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University