View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5984_low_15 (Length: 250)
Name: NF5984_low_15
Description: NF5984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5984_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 37129448 - 37129689
Alignment:
| Q |
1 |
gctaatctttctgtatcaggttgcatgctcaggctcttacactgggagcattagctggagctgcagtggtagaatattatgatcataagtctgaagaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37129448 |
gctaatctttctgtatcaggttgcatgctcaggctcttacactgggagcattagctggagctgcagtggtagaatattatgatcataagtctgaagaaaa |
37129547 |
T |
|
| Q |
101 |
ggctaaggctgcaagggattctaggcgataaatctaacgaagtttgagtttccgaaattctttatactagctgatatttgtatctgacatctcacagctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37129548 |
ggctaaggctgcaagggattctaggcgataaatctaacgaagtttgagtttccgaaattctttatactagctgatatttgtatctgacatctcacagctt |
37129647 |
T |
|
| Q |
201 |
ggcatagtagaattttagtgattgcaaattttgcagtataat |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37129648 |
ggcatagtagaattttagtgattgcaaattttgcagtataat |
37129689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University