View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5984_low_18 (Length: 237)
Name: NF5984_low_18
Description: NF5984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5984_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 47695349 - 47695570
Alignment:
| Q |
1 |
catgcctcttgataccacaatattgcattactaaagatgtgaaagcagcagtgtctgcttgttttcaatccagtgcaacttattttcagttttcatgctc |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47695349 |
catgcctcttgataccacaatattgtattactaaagatgtgaaagcagcagtgtctgcttgttttcaatccagtgcaacttattttcagttttcatgctc |
47695448 |
T |
 |
| Q |
101 |
tgcagttttgagcagttctgcattaattttacaaatgagaagttgcaacagcatttcaatcaggcaaaatctcagaccagataagaagcttcattttgtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47695449 |
tgcagttttgagcagttctgcattaattttacaaatgagaagttgcaacagcatttcaatcaggcaaaatctcagaccagataagaagcttcattttgtt |
47695548 |
T |
 |
| Q |
201 |
atgaccattatttccatgttta |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
47695549 |
atgaccattatttccatgttta |
47695570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 74; Significance: 4e-34; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 77 - 177
Target Start/End: Complemental strand, 35830453 - 35830352
Alignment:
| Q |
77 |
aacttattttcagttt-tcatgctctgcagttttgagcagttctgcattaattttacaaatgagaagttgcaacagcatttcaatcaggcaaaatctcag |
175 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||| |||||||| || ||||||||||||||||||| |||| |
|
|
| T |
35830453 |
aacttattttcagtttgtcatgctctgcagttttgagcagttctgcattaatttcacaaatgaaaagttgcagcaacatttcaatcaggcaaaatttcag |
35830354 |
T |
 |
| Q |
176 |
ac |
177 |
Q |
| |
|
|| |
|
|
| T |
35830353 |
ac |
35830352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 164
Target Start/End: Complemental strand, 31009758 - 31009696
Alignment:
| Q |
102 |
gcagttttgagcagttctgcattaattttacaaatgagaagttgcaacagcatttcaatcagg |
164 |
Q |
| |
|
|||||||||||||||| || ||||||||||| ||||| ||| |||| ||||| ||||| |||| |
|
|
| T |
31009758 |
gcagttttgagcagttttgtattaattttacgaatgaaaagctgcagcagcacttcaaccagg |
31009696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 164
Target Start/End: Complemental strand, 31187606 - 31187544
Alignment:
| Q |
102 |
gcagttttgagcagttctgcattaattttacaaatgagaagttgcaacagcatttcaatcagg |
164 |
Q |
| |
|
|||||||||||||||| || ||||||||||| ||||| ||| |||| ||||| ||||| |||| |
|
|
| T |
31187606 |
gcagttttgagcagttttgtattaattttacgaatgaaaagctgcagcagcacttcaaccagg |
31187544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 164
Target Start/End: Complemental strand, 52153265 - 52153205
Alignment:
| Q |
104 |
agttttgagcagttctgcattaattttacaaatgagaagttgcaacagcatttcaatcagg |
164 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| | || || ||||| ||||||| |
|
|
| T |
52153265 |
agttttgagcagttctgtattaattttacaaatgagaagctacagcaacattttaatcagg |
52153205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 103 - 167
Target Start/End: Original strand, 26466609 - 26466673
Alignment:
| Q |
103 |
cagttttgagcagttctgcattaattttacaaatgagaagttgcaacagcatttcaatcaggcaa |
167 |
Q |
| |
|
|||||||||||| | ||||| || || |||||||||||||| ||||| ||||| |||||||||| |
|
|
| T |
26466609 |
cagttttgagcaactatgcatcaacttaacaaatgagaagttacaacaacattttaatcaggcaa |
26466673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University