View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5984_low_19 (Length: 229)
Name: NF5984_low_19
Description: NF5984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5984_low_19 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 47695288 - 47695060
Alignment:
| Q |
1 |
aaggaccccgatcaaagatttagaattggcatcttgtccaattgaattgttaatcttgtccaccaacctgttaacaaccatgttagtgcaccaaggatca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
47695288 |
aaggaccccgatcaaagatttagaattggcatcttgtccaattgaattgttaatcttgtccaccaacctgttaacaaccatgttaatgcaccaaggatca |
47695189 |
T |
 |
| Q |
101 |
aaaccatagtccaagattcctgccttatgaatttgtagtccgaactagaattacgaaggacggcactatagattggtttccattttcagcatcttaccag |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47695188 |
aaaccatagtccaagatccctgccttatgaatttgtagtccgaactagaattacgaaggacggcactatagattggtttccattttcagcatcttaccag |
47695089 |
T |
 |
| Q |
201 |
tcaaagagcctagaatacattgtttttgc |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
47695088 |
tcaaagagcctagaatacattgtttttgc |
47695060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 35830607 - 35830671
Alignment:
| Q |
1 |
aaggaccccgatcaaagatttagaattggcatcttgtccaattgaattgttaatcttgtccacca |
65 |
Q |
| |
|
||||||||| |||||| |||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
35830607 |
aaggaccccaatcaaacatttagaattggggtcttgtccaattgaattattaatcttgtccacca |
35830671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University