View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5987_high_26 (Length: 235)
Name: NF5987_high_26
Description: NF5987
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5987_high_26 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 14 - 235
Target Start/End: Complemental strand, 36227699 - 36227476
Alignment:
| Q |
14 |
ccaaacactcccttaatgcttgtaatggttaagattcttgt--ttattgttctcgtcaaattctttatatttagaaaaatgagatgattatcatgaactt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36227699 |
ccaaacactcccttaatgcttgtaatggttaagattattgtgtttattgttctcgtcaaattctttatatttagaaaaatgagatgattatcatgaactt |
36227600 |
T |
|
| Q |
112 |
ctaaattgatgatctgcttattcatgtgagtgatgttcatctaactatgtctgtagccaagaatgtgaatgtgttggttggttaataatgtctaagatat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36227599 |
ctaaattgatgatctgcttattcatgtgagtgatgttcatctaactatgtctgtagccaagaatgtgaatgtgttggttggttaataatgtctaagatat |
36227500 |
T |
|
| Q |
212 |
tttatgatttcggaactttgattt |
235 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
36227499 |
tttatgatttcggaactttgattt |
36227476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University