View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5987_high_27 (Length: 211)
Name: NF5987_high_27
Description: NF5987
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5987_high_27 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 195
Target Start/End: Original strand, 10751801 - 10751995
Alignment:
| Q |
1 |
aagatgatcggaatgagtgttgcgagcatgtgcgaagctgatgtaagatggccttcttatgcatacaatatacaaggtgaatcaaatggtgcaatgagat |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10751801 |
aagatgatcggaatgagtgtcgcgagcatgtgcgaagctgatgtaagatggccttcttatgcatacaatatacaaggtgaatcaaatggtgcaatgagat |
10751900 |
T |
|
| Q |
101 |
ggattacaaatatgtctgaatcaagtcttcaaacaataagctatggcaccaatcatatctatgattgcaagggtcatatttaattttctgcttct |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10751901 |
ggattacaaatatgtctgaatcaagtcttcaaacaataagctatggcaccaatcatatctatgattgcaagggtcatatttaattttctgcttct |
10751995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 39 - 149
Target Start/End: Original strand, 32561286 - 32561396
Alignment:
| Q |
39 |
tgatgtaagatggccttcttatgcatacaatatacaaggtgaatcaaatggtgcaatgagatggattacaaatatgtctgaatcaagtcttcaaacaata |
138 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||| |||| |||| |||||| | ||||||||| |||||||||||||||| ||||| ||||| | || |
|
|
| T |
32561286 |
tgatgtaagatggccttcttttgcatataatataaaaggagaattgaatggtcctatgagatgggttacaaatatgtctgattcaagccttcatgctatc |
32561385 |
T |
|
| Q |
139 |
agctatggcac |
149 |
Q |
| |
|
||||||||||| |
|
|
| T |
32561386 |
agctatggcac |
32561396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University