View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5987_low_29 (Length: 210)

Name: NF5987_low_29
Description: NF5987
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5987_low_29
NF5987_low_29
[»] chr3 (1 HSPs)
chr3 (19-200)||(52289164-52289345)


Alignment Details
Target: chr3 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 19 - 200
Target Start/End: Original strand, 52289164 - 52289345
Alignment:
19 ttactagtgcaagtactaaaaatccacgaaagtcccacaatctactcaagatattattaagattaattgctttagcaatcaaccatatccgtgcaacttt 118  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
52289164 ttactagtgcaagtactaaaaatccacgatagtcccacaatctactcaagatattattaagattaattgctttagcaatcaaccatatccttgcaacttt 52289263  T
119 ttgtcacataatttttcttcaatggtgaactgaaggacacactttttgaacttaagactctccaagacttctgttgatgatg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52289264 ttgtcacataatttttcttcaatggtgaactgaaggacacactttttgaacttaagactctccaagacttctgttgatgatg 52289345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University