View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5987_low_30 (Length: 207)
Name: NF5987_low_30
Description: NF5987
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5987_low_30 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 17 - 195
Target Start/End: Original strand, 36453215 - 36453393
Alignment:
| Q |
17 |
aaattacgtaccatttgactttaacaactcgttttcaatttatgaaagatgttagttttatcgtggttgtgcatttggaaaggttggcttgaagtaattt |
116 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36453215 |
aaattgcgtaccatttgactttaacaactcgttttcaatttatgaaagatgttagttttatcgtggttgtgcatttggaaaggttggctttaagtaattt |
36453314 |
T |
|
| Q |
117 |
tattagtgttgatgaaaaggaaaaagaaagaatacgtaacaaaactacattctttaacactagttacttactctctgct |
195 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36453315 |
cattagcgttgatgaaaaggaaaaataaagaatacgtaacaaaactacattctttaacactagttacttactctatgct |
36453393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University