View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5988_high_13 (Length: 280)
Name: NF5988_high_13
Description: NF5988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5988_high_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 262
Target Start/End: Original strand, 40804722 - 40804983
Alignment:
| Q |
1 |
taaatcattggcagtacaaaccatagctggtttagcatcctttctcagactctcatcaacatccagttccttctgcaaaaccatgacatcacaagcttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40804722 |
taaatcattggcagtacaaaccatagctggtttagcatcctttctcagactctcatcaacatccagttccttctgcaaaaccatgacatcacaagcttca |
40804821 |
T |
|
| Q |
101 |
ttcagtaagctactagactttaattaatcaaaactcttttcagtacttcactttgtctaaatggttataaagtttccaaatagctagctggcagatacta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40804822 |
ttcagtaagctactagactttaattaatcaaaactcttttcagtacttcactttgtctaaatggttataaagattccaaatagctagctggcagatacta |
40804921 |
T |
|
| Q |
201 |
atcactgtacaatgtgacatgccatgaaaagattaaccccaaccatattcagatgaacactc |
262 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40804922 |
atcactgtacaaagtggcatgccatgaaaagattaaccccaaccatattcagatgaacactc |
40804983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 4640767 - 4640725
Alignment:
| Q |
1 |
taaatcattggcagtacaaaccatagctggtttagcatccttt |
43 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
4640767 |
taaatcattggcagtgcaaaccatagctggtttggcatccttt |
4640725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University