View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5988_high_16 (Length: 250)
Name: NF5988_high_16
Description: NF5988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5988_high_16 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 57 - 250
Target Start/End: Complemental strand, 3419739 - 3419543
Alignment:
| Q |
57 |
tgttagaaaagtatagggtgttgcggtcttttttatttaattaagtaacgtaaccaaaataatcannnnnnnnn--agagaataaccaaaataatcaagt |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3419739 |
tgttagaaaagtatagggtgttgcggtcttttttatttaattaagtaacgtaaccaaaataatcaatttttttttgagagaataaccaaaataatcaagt |
3419640 |
T |
 |
| Q |
155 |
aaatgccatttatattaataata-taagaatgcagataatgtggtccccaattatgacaacgacaatgagatgtgttttctggtgcgacaagtgcca |
250 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3419639 |
aaatgccatttatattaataataataagaatgcagataatgtggtccccaattatgacaacgacaatgagatgtgttttctggtgcgacaagtgcca |
3419543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University