View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5988_low_13 (Length: 357)
Name: NF5988_low_13
Description: NF5988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5988_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-118; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 1 - 251
Target Start/End: Original strand, 15706876 - 15707137
Alignment:
| Q |
1 |
tagcgatgataagggaaggatgtttatctgcttttaatacgcctactgaagaaacagatggattgattggtaatatgttcattcaatcttcaattatttg |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15706876 |
tagcaatgataagggaaggatgtttatcggcttttaatacgcctactgaagaaacagatggattgattggtaatatgttcattcaatcttcaattatttg |
15706975 |
T |
 |
| Q |
101 |
atctagtttctttgagagaaataaaaataaaatatgagagaaatgggtccttcattaatta-----------tattgctaccattaatgctgaggaaaca |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
15706976 |
atctagtttctttgagagaaataaaaataaaatatgagagaaatgggtccttcattaattagttggtaatgttattgctaccattaatgctgaggaaaca |
15707075 |
T |
 |
| Q |
190 |
ataatgcaaaggaagctgccttgacatgaaggtcaaatagttgcatatcatcactagagatt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15707076 |
ataatgcaaaggaagctgccttgacatgaaggtcaaatagttgcatatcatcactagagatt |
15707137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 247 - 341
Target Start/End: Original strand, 15709165 - 15709259
Alignment:
| Q |
247 |
agattgaaggatagtttcatgcacattgatattaatcaaatggtgcaaaagcattcatgctctggcagccgatattacgctaagtcggaactttc |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15709165 |
agattgaaggatagtttcatgcacattgatattaatcaaatggtgcaaaagcattcatgctctggcagccgatattacgctaagtcggaactttc |
15709259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University