View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5989_high_20 (Length: 249)
Name: NF5989_high_20
Description: NF5989
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5989_high_20 |
 |  |
|
| [»] scaffold0891 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0891 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: scaffold0891
Description:
Target: scaffold0891; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 299 - 523
Alignment:
| Q |
1 |
tttggactgcttcggcttctggcttgttgggatatttacaatacgatgagcttgttaacaggggaattattcccttcaaaggtaagttaaacgagtagta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
299 |
tttggactgcttcggcttctggcttgttgggatatttacaatacgatgagcttgttaacaggggaattattcccttcaaaggtaagttaaacgagtagta |
398 |
T |
 |
| Q |
101 |
tatctcctt-tgtaattgttttctgcatatatgaagcacggagactttaggaactaggtgtgtcgtggtgtcagacacttgaacgataaatgttagacaa |
199 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| |||| ||| |||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
399 |
tatctccttctgtaattgttttctgcatatatgaagcacgg-cacttcagggactaggtgtgtcgtggtgtcagacacttgaacgatacatgttagacaa |
497 |
T |
 |
| Q |
200 |
ctcagaaagtgcccgaaataaagttg |
225 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
498 |
ctcagaaagtgcccgaaataaagttg |
523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 35775997 - 35775909
Alignment:
| Q |
1 |
tttggactgcttcggcttctggcttgttgggatatttacaatacgatgagcttgttaacaggggaattattcccttcaaaggtaagtta |
89 |
Q |
| |
|
||||||||||||| |||| |||| |||||||||||||||| ||||||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
35775997 |
tttggactgcttctgcttgtggcatgttgggatatttacagtacgatgagcttgttgagaggggaattattcccttcaaaggtaagtta |
35775909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 84
Target Start/End: Complemental strand, 35854312 - 35854229
Alignment:
| Q |
1 |
tttggactgcttcggcttctggcttgttgggatatttacaatacgatgagcttgttaacaggggaattattcccttcaaaggta |
84 |
Q |
| |
|
||||||||||||| |||| |||||| | |||||||| ||||| |||||||||||||| || |||||| |||| |||||||||| |
|
|
| T |
35854312 |
tttggactgcttctgcttgtggctttgtcggatatttgcaatatgatgagcttgttaaaagaggaattcttccattcaaaggta |
35854229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University