View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5989_low_25 (Length: 237)
Name: NF5989_low_25
Description: NF5989
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5989_low_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 163
Target Start/End: Original strand, 19146850 - 19147016
Alignment:
| Q |
1 |
tgctctttggccttgacctagggttgtgagttgatcaacgatgggttttcatgttctgatggtgctatctctttgagagttgctaacaaggcggtatgc- |
99 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19146850 |
tgctctttggccttgacctagggtggtgagttgatcaacgatgggttttcatgttctgatggcgctatctctttgtgagttgctaacaaggcggtatgct |
19146949 |
T |
 |
| Q |
100 |
---tcaaaagtgagaggtacttgtgtggctcctcgtgttccaatagtagattatctccttggtgatg |
163 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
19146950 |
cgatcaaaagtgagaggtacgtgtgtggctcctcgtgtgccaatagtagattatctccttggtgatg |
19147016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 172 - 229
Target Start/End: Original strand, 19147261 - 19147319
Alignment:
| Q |
172 |
tctttatcgatgatttt-ttgcatttataatgatgtatttgtgaattgtttatgatgat |
229 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19147261 |
tctttatcaatgatttttttgcatttataatgatgtatttgtgaattgtttatgatgat |
19147319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University