View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5990_low_6 (Length: 226)
Name: NF5990_low_6
Description: NF5990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5990_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 11410417 - 11410618
Alignment:
| Q |
1 |
ttatgccttaaacaatcatgggtcggtgttgaattaccatatttttcacttttttgctgtattagagatgccaagttgataaagtttgannnnnnncatc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
11410417 |
ttatgccttaaacaatcatgggtcggtgttgaattaccatatttttcacttttttgctgtattagagatgccaagttgataaagtttgatttttttcatc |
11410516 |
T |
 |
| Q |
101 |
tgggtggtgaataatttgatgctaatattttctttaagtgaatgtagtttttcataaagaattttgttttgtttgtgaaaattgagtttagagggccaca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11410517 |
tgggtggtgaataatttgatgctaatattctctttgagtgaatgtagtttttcaaaaagaattttgttttgtttgtgaaaattgagtttagagggccaca |
11410616 |
T |
 |
| Q |
201 |
ag |
202 |
Q |
| |
|
|| |
|
|
| T |
11410617 |
ag |
11410618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University