View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5991_high_6 (Length: 393)
Name: NF5991_high_6
Description: NF5991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5991_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 357; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 357; E-Value: 0
Query Start/End: Original strand, 2 - 378
Target Start/End: Original strand, 30788875 - 30789250
Alignment:
| Q |
2 |
gaggaggagcagagatggtctctaactggaatgacagcacttgttaccggtggcactcgtggaatcgggttttcatctttctccttttccgttatttcat |
101 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
30788875 |
gaggagga-cagagatggtctctaactggaatgacagcacttgttaccggtggcactcgtggaatcgggttttcatctttctccttttcccttatttcat |
30788973 |
T |
 |
| Q |
102 |
tgtttatcttatcttcaacaccctgcatcattattcatatgtagtctttattttgatctagccaaaaatacttcattatcttttacactctccgttttaa |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30788974 |
tgtttatcttatcttcaacaccctgcatcattattcatatgtagtctttattttgatctagccaaaaatacttcattatcttttacactctccgttttaa |
30789073 |
T |
 |
| Q |
202 |
gattagtgtcgtttaaaggtttttgcacacggactaacactgcaacataattgagatctagttacatttgaacaattgttaggtattactaaagagcttt |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
30789074 |
gattagtgtcgtttaaaggtttttgcacacggactaacactgcaacataattgagatctagttacatttggacaattgttaggtattactaaagagcttt |
30789173 |
T |
 |
| Q |
302 |
agtaacattttaccaaagagatgatacttttattaagaatagattttaatccatccattcatttgacacattgttta |
378 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30789174 |
agtaacattttaccaaagagatgatacttttattaagaaaagattttaatccatccattcatttgacacattgttta |
30789250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University