View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5991_low_20 (Length: 248)
Name: NF5991_low_20
Description: NF5991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5991_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 50417397 - 50417172
Alignment:
| Q |
1 |
taacttttcttctaaattctaaatttcatccttttatttgaaactctccaacgacgattggcgtcgctttcttaaagtagaaactcatagtataacctgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50417397 |
taacttttcttctaaattctaaatttcatccttttatttgaaactctccaacgacgattggcgtcgctttcttaaagtagaaactcatagtataacctgt |
50417298 |
T |
|
| Q |
101 |
ccttacgactgaaacgatgaccaaatcacctaatcggagttggctctaccgaaaacaagggaaattagtgtctcaaaactcaacttatatcaattttatc |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
50417297 |
ccttacaactgaaacgatgaccaaatcacctaatcggagttggctctaccgaaaacaagggaaattagtgtctcaaaactcagcttatatcaattttatc |
50417198 |
T |
|
| Q |
201 |
ttatttttgttgaatc-acaccgacc |
225 |
Q |
| |
|
|||||||||||||||| ||||||||| |
|
|
| T |
50417197 |
ttatttttgttgaatcaacaccgacc |
50417172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 164 - 217
Target Start/End: Complemental strand, 26845428 - 26845375
Alignment:
| Q |
164 |
attagtgtctcaaaactcaacttatatcaattttatcttatttttgttgaatca |
217 |
Q |
| |
|
|||||| |||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
26845428 |
attagtatctcaaaactcaacttatatatgatttctcttatttttgttgaatca |
26845375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University