View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5992_high_16 (Length: 268)
Name: NF5992_high_16
Description: NF5992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5992_high_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 129; Significance: 8e-67; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 14 - 250
Target Start/End: Complemental strand, 7064554 - 7064334
Alignment:
| Q |
14 |
atatgtagcaagatattcttaaaacaaataactaaatgtgtcatcattccttaatcattttatccttgacataaattgtatgtacttgagtccttcaann |
113 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7064554 |
atatgtaccaagatattcttaaaacaaataactaaatgtgtcatcattccttaatcattttat----------------atgtacttgagtccttcaatt |
7064471 |
T |
|
| Q |
114 |
nnnnnnggtcaaagtttactttctgaccgatgcacatgaagnnnnnnnnncataaatcaaaatatgtttaacatctcaaataaattttagttactttaaa |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7064470 |
ttttttggtcaaagtttactttctgaccgatgcacatgaagaaaaaaaaacataaatcaaaatatgtttaacatctcaaataaattttagttactttaaa |
7064371 |
T |
|
| Q |
214 |
ttagtttttacaattgtgtgaagatatatctttagtt |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7064370 |
ttagtttttacaattgtgtgaagatatatctttagtt |
7064334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University