View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5992_low_13 (Length: 291)
Name: NF5992_low_13
Description: NF5992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5992_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 276
Target Start/End: Original strand, 28219319 - 28219595
Alignment:
| Q |
1 |
agtcaaattatagggctttcttcaatccagaaagagccg-gcccaattcggtctgttttgctaaactatgggctgtacaggtagttagtctattaacttg |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28219319 |
agtcaaattatagggctttcttcaatccagaaagtgcccagcccaattcggtctgttttgttaaactatgggctgcacaggtagttagtctattaacttg |
28219418 |
T |
 |
| Q |
100 |
cataaatatagtatgggaaattctattcccaccccatgcatctatcaaaatcagcaaaaagccttaccaaaagttggattttggtaggcattgtgaagga |
199 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28219419 |
cataaatatagtatgggaaattctactcccaccccatgcatctatcaaaatcagcaaaaagccttaccaaaagttggattttggtaggcattgtgaagga |
28219518 |
T |
 |
| Q |
200 |
aattaaggtttcaataaacatgttaaccatagcttctacttggtggggggatttcgagcatcatcggaggtggaatg |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28219519 |
aattaaggtttcaataaacatgttaaccatagcttctacttggtggggggatttcgagcatcatcggaggtggaatg |
28219595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University