View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5993_high_21 (Length: 373)
Name: NF5993_high_21
Description: NF5993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5993_high_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 77; Significance: 1e-35; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 189 - 281
Target Start/End: Complemental strand, 28777588 - 28777496
Alignment:
| Q |
189 |
taataacattttctttccaactcaacttttaatttacgaattaggtggcatttagcttgcaccatcaaataaattggtccaacttagaccatt |
281 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
28777588 |
taataacattttctttccaactcaatttttaatttacgaattaggtggcatttagcttgcactaccaaatagattggtccaacttagaccatt |
28777496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 3 - 56
Target Start/End: Complemental strand, 28777760 - 28777707
Alignment:
| Q |
3 |
ttaagaaacattcttattattctaactagcattgggacactatcctattgtcca |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28777760 |
ttaagaaacattcttattattctaactagcattgggacactatcatattgtcca |
28777707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 283 - 328
Target Start/End: Complemental strand, 28777454 - 28777409
Alignment:
| Q |
283 |
aactctacctcactctttgtaactctgtctctggaaccaaaaagac |
328 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
28777454 |
aactctacctcactctttgcaactctgtctctggaaccaaaaagac |
28777409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University