View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5993_high_43 (Length: 250)
Name: NF5993_high_43
Description: NF5993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5993_high_43 |
 | |
|
| [»] scaffold0393 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 15 - 233
Target Start/End: Complemental strand, 2411782 - 2411564
Alignment:
| Q |
15 |
cacagaggatcttcattgccttcactatcagttcatccacagacaataggatgtgatggaggtttcaatccgtttttccattcaatgaatcagaacccta |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2411782 |
cacagaggatcttcattgccttcactatcagttcatccacagacaataggatgtgatggaggtttcaatccgtttttccattcaatgaatcagaacccta |
2411683 |
T |
|
| Q |
115 |
atatattggttggagccatagttggaggtccaaaccaaaacgatggatttccggatgaccgtggtgattatagtcattcagaaccagcaacttacatcaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2411682 |
atatattggttggagccatagttggaggtccaaaccaaaacgatggatttccggatgaccgtggtgattatagtcattcagaaccagcaacttacatcaa |
2411583 |
T |
|
| Q |
215 |
tggtgggattgttggacct |
233 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
2411582 |
tggtgggattgttggacct |
2411564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0393 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: scaffold0393
Description:
Target: scaffold0393; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 15 - 233
Target Start/End: Complemental strand, 14167 - 13945
Alignment:
| Q |
15 |
cacagaggatcttcattgccttcactatcagttcatccacagacaataggatgtgatggaggtttcaatccgtttttccattcaatgaatcagaacccta |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14167 |
cacagaggatcttcattgccttcactatcagttcatccgcagacaataggatgtgatggaggtttcaatccgtttttccattcaatgaatcagaacccta |
14068 |
T |
|
| Q |
115 |
atatattggttggagccatagttggaggtccaaaccaaaacgatggatttccggatgaccgtggtgattata----gtcattcagaaccagcaacttaca |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| || |||||||||| |||||| ||||||||||||||||| |
|
|
| T |
14067 |
atatattggttggagccatagttggaggtccaaaccagaacgacggatttccggatgatcgcggtgattatagtcagtcattgagaaccagcaacttaca |
13968 |
T |
|
| Q |
211 |
tcaatggtgggattgttggacct |
233 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
13967 |
tcaatggtgggattgttggacct |
13945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University