View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5993_high_44 (Length: 250)
Name: NF5993_high_44
Description: NF5993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5993_high_44 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 31 - 233
Target Start/End: Complemental strand, 52511137 - 52510935
Alignment:
| Q |
31 |
ataaactcattcaagtattcttattcgttgtattatacttgctaataaggatactttaaaataaaactcattttaagaataaattagtatactcgatgan |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
52511137 |
ataaactcattcaagtattcttattcgttgtattatacttgctaataaggatactttaaaataaatatcattttaagaataaattagtatactcgatgat |
52511038 |
T |
 |
| Q |
131 |
nnnnnnnaagaaatcaaataaaatatatataaattaataagtcagtcaaacataagatgtgtctagaattgaaaaataaaataattcataaacaggagta |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52511037 |
tttttttaagaaatcaaataaaatatatataaattaagaagtcagtcaagcataagatgtgtctagaattgaaaaataaaataattcataaacaggagta |
52510938 |
T |
 |
| Q |
231 |
tat |
233 |
Q |
| |
|
||| |
|
|
| T |
52510937 |
tat |
52510935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University