View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5993_high_47 (Length: 243)
Name: NF5993_high_47
Description: NF5993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5993_high_47 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 10 - 209
Target Start/End: Complemental strand, 26865818 - 26865620
Alignment:
| Q |
10 |
caatgaaatggtgatgaccaagattttcgtgacagcaacaacataagatgcaatccttgagccagcttggagccttctttgtgcgttggggtccttgtgg |
109 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26865818 |
caatgaaatggtgatgaccaggattttcgtgacagcaacaacataagatgcaatccttgagccagcttggagccttctttgtgcgttggggtccttgtgg |
26865719 |
T |
 |
| Q |
110 |
tttcggcctccattgggtccactgcctacattaggccgaattttaacgatttagtccaaatagttccttcgtcctgcattatagaggtattattatattt |
209 |
Q |
| |
|
||| |||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26865718 |
ttttggcctccattgggtccactg-ctacattaggccgaattttaacgatttagttcaaatagttccttcgtcctgcattatagaggtattattatattt |
26865620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University