View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5993_high_48 (Length: 242)
Name: NF5993_high_48
Description: NF5993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5993_high_48 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 33897236 - 33897009
Alignment:
| Q |
1 |
caatgggaatatataattccaggttttggagagatacttggataggtgattcatcgttgtttacttcttttcccgagtttaagaaaaatagggttgaaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
33897236 |
caatgggaatatataattccaggttttggagagatacttggataggtgattcatcgttgtttacttgttttcccgagtttaagaaaaatagggtggaaga |
33897137 |
T |
 |
| Q |
101 |
ctacttgggaaggaaggagatgatttgttatggcggagaaatttgtttgactagagcgttctttaagtgatagtcttttggagctcttaaacgtttcaac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33897136 |
ctacttgggaaggaaggagatgatttgttatggcggagaaatttgtttgactagatcgttctttaagtgatagtcttttggagctcttaaacgtttcaac |
33897037 |
T |
 |
| Q |
201 |
atggaatggagaggatatgtagtttttg |
228 |
Q |
| |
|
|||||||||| ||||||||||||||||| |
|
|
| T |
33897036 |
atggaatggataggatatgtagtttttg |
33897009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University