View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5993_low_28 (Length: 343)
Name: NF5993_low_28
Description: NF5993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5993_low_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 2e-80; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 1 - 180
Target Start/End: Complemental strand, 29631817 - 29631638
Alignment:
| Q |
1 |
acatgacggccttctagaaccttgggaatgcagtgtcgttgcacgggccgaggagattgcatcccgactttatcgcaaccccgctccatccattccgaga |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
29631817 |
acatgacggccttctagaacctttggaatgcagtgtcgttgcacgggccgcggagattgcatcccgagtttatcgcaaccccgcaccatccattccgaga |
29631718 |
T |
|
| Q |
101 |
gtccgagatctgaaaacgacgtgtgtttgtcgtttccagcgttatcacagtccgttgtattgcaatagctagctgctgag |
180 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
29631717 |
gtcctagatctgaaaacgacatgtgtttgtcgtttccagcgttatcacagtccgttgtattacaatagctagctgctgag |
29631638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 216 - 328
Target Start/End: Complemental strand, 29631603 - 29631491
Alignment:
| Q |
216 |
gaagtaagctgttacggttgaccaggaaggaagaaagggaaaggagagagtgcgactcactggttatgggagaaatccatgtgcggctgccaggtttaga |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29631603 |
gaagtaagctgttacggttgaccaggaaggaagaaagggaaaggagagagtgcgactcactggttatgggagaaatccatgtgcggctgccaggtttaga |
29631504 |
T |
|
| Q |
316 |
atccatttcacag |
328 |
Q |
| |
|
||||||||||||| |
|
|
| T |
29631503 |
atccatttcacag |
29631491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 29630698 - 29630583
Alignment:
| Q |
1 |
acatgacggccttctagaaccttgggaatgcagtgtcgttgcacgggccgaggagattgcatcccgactttatcgcaaccccgctccatccattccgaga |
100 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||| |||||||| |||| || | ||||||||||| || | |||| | || || |||||||||||| |
|
|
| T |
29630698 |
acatcacggccttctagaaccttaggaatgcagtgttgttgcacgcgccgcggtgtttgcatcccgagcttcttgcaattctgcaccgtccattccgaga |
29630599 |
T |
|
| Q |
101 |
gtccgagatctgaaaa |
116 |
Q |
| |
|
|||||||||| ||||| |
|
|
| T |
29630598 |
gtccgagatcggaaaa |
29630583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University