View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5993_low_44 (Length: 251)
Name: NF5993_low_44
Description: NF5993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5993_low_44 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 251
Target Start/End: Original strand, 45704929 - 45705172
Alignment:
| Q |
1 |
ttattgcatcctttgtctgtttaaaaacccttcagccgtcaattataaatattatataagcagttgaattgctgaactgcttggtttggtacacacaccg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | ||||||||||| ||||||| || ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
45704929 |
ttattgcatcctttgtctgtttaaaaacccttcagtcatcaattataaaaattatatgagtagtcgaattgctgaactgcttggtttggtacacacaccg |
45705028 |
T |
|
| Q |
101 |
tctgctgaacaggttaagattccgttgagactggaacatgccaaaaatttgagacagatgttaggacttaggatctcatgagaagttttgcaaagaggtc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
45705029 |
tctgctgaacaggttaagattccgttgagactggaacatgccaaaaatttgagacagatg-------ttaggatctcaagagaagttttgcaaagaggtc |
45705121 |
T |
|
| Q |
201 |
ttggtatttatcatgaacaacgtcaacaaatctagtttccttcggtcaaca |
251 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
45705122 |
ttggtatttatcataaacaacgtcaacaaatctagtttccttcggtcaaca |
45705172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University