View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5993_low_47 (Length: 250)
Name: NF5993_low_47
Description: NF5993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5993_low_47 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 48451517 - 48451759
Alignment:
| Q |
1 |
aaagtgaaaattctcaaatatcaacttatctatcattctgaatccctacctcatagttatatttatttccttactatgtgattaaatttcttttattgca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48451517 |
aaagtgaaaattctcaaatatcaacttatctatcattctgaatccctacctcatagttatatttatttccttactatgtgattaaatttcttttattgca |
48451616 |
T |
 |
| Q |
101 |
ttcactgttacccacttgtgtgttctctaaattaacatttgtgtgacattatgaaaactttgcagtcaaaattactgataaccctgcggacaagttagta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48451617 |
ttcactgttacccacttgtgtgttctctacattaacatttgtgtgacattatgaaaactttgcagtcaaaattactgataaccctgcggacaagttagta |
48451716 |
T |
 |
| Q |
201 |
gctgctatcaacgaaaatagaactgctcacaaggattcatctc |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48451717 |
gctgctatcaacgaaaatagaactgctcacaaggattcatctc |
48451759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University