View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5993_low_56 (Length: 235)
Name: NF5993_low_56
Description: NF5993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5993_low_56 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 34 - 219
Target Start/End: Original strand, 32490059 - 32490248
Alignment:
| Q |
34 |
tagtagtagtagtaataatagta----gttgtcgatttgaccgtgggatctgaaggaatactttgtgatattatctcagtattcaagtgagcctaatgat |
129 |
Q |
| |
|
||||||||||||||||||||||| |||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32490059 |
tagtagtagtagtaataatagtacgtagttgtcaatttgaccgtaggatctgaaggaatactttgtgatattatctcagtattcaagtgagcctaatgat |
32490158 |
T |
|
| Q |
130 |
ggtagtccagaaacaatgtcgtgagattctgcaccagtgttgttcatcctttgtccagaacttggaccaagggattctatcgcttcttct |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32490159 |
ggtagtccagaaacaatgtcgtgagattctgcaccagtgttgttcatcctttgtccagaacttggaccaagggattctatcgcttcttct |
32490248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University