View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5994_high_8 (Length: 311)
Name: NF5994_high_8
Description: NF5994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5994_high_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 1 - 301
Target Start/End: Complemental strand, 47468256 - 47467956
Alignment:
| Q |
1 |
ttctagagaagagatatacctttgatcgaatagttttacttccttgatttggaaccttttgatttgagtatgaataccaagttctttcttacaattccta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47468256 |
ttctagagaagagatatacctttgatcgaatagttttacttccttgatttggaaccttttgatttgagtatgaataccaagttctttcttacaattccta |
47468157 |
T |
|
| Q |
101 |
acttaatgattttttatatcctttacaattctttctcgaaatgacttcagttgtttggtgacaactcttacagggaacttggcattggaatagtaccgta |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47468156 |
acttaatgatttttgatatcctttacaattctttctcgaaatgacttcagttgtttggtgacaactcttacagggaacttggcattggaatagtaccgta |
47468057 |
T |
|
| Q |
201 |
cagtccccttggccgtggattttttggaggcaaggctattacagaaagtgtacctgcagacagttttctggtatggactcgacccgatttgtttctgatg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47468056 |
cagtccccttggccgtggattttttggaggcaaggctattacagaaagtgtacctgcagacagttttctggtatggactcgacccgatttgtttctgatg |
47467957 |
T |
|
| Q |
301 |
a |
301 |
Q |
| |
|
| |
|
|
| T |
47467956 |
a |
47467956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University