View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5994_high_9 (Length: 229)
Name: NF5994_high_9
Description: NF5994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5994_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 40 - 215
Target Start/End: Original strand, 42041836 - 42042013
Alignment:
| Q |
40 |
gtccaattatgatagagttcggttctagtaattcaaagttcgattaagaggataagtaaaattcaacttaaaattgttcgatttaaatattgaactattt |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42041836 |
gtccaattatgatagagttcggttctagtaattcaaagttcgattaagaggataagtaaaactcaacttaaaattgttcgatttaaatattgaactattt |
42041935 |
T |
 |
| Q |
140 |
taaagtttttaaacaattcgtc-tgtaatgattctctttctat-cggcatccatattgctgcaaaaccccatcatgat |
215 |
Q |
| |
|
|||| ||||||||||||||||| | ||||||| |||||||||| | | ||||||||||||||||||||||||||||| |
|
|
| T |
42041936 |
taaattttttaaacaattcgtcttttaatgatactctttctatcccccctccatattgctgcaaaaccccatcatgat |
42042013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University