View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5995_high_5 (Length: 393)
Name: NF5995_high_5
Description: NF5995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5995_high_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 19 - 388
Target Start/End: Complemental strand, 979223 - 978850
Alignment:
| Q |
19 |
atattaatacttgggttctaatactcagagtttt-tcccctgtttacatctcaatttccaaccgaattatgttcctttgagtttattctttggctttcct |
117 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
979223 |
atattaatacctgggttctaatactcagagttttatcccctgtttacatctcaatttccaatcgaatcaggttcctttgagtttattctttggctttcct |
979124 |
T |
|
| Q |
118 |
ttttgccttttcttcaccttgacccaagattaatcccctcttcttgatttctgaggtttttcctttgcttttgtttgggtccccctggtgctagaatctt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
979123 |
ttttgccttttcttcaccttgacccaagattaatcttctcttcttgatttttgaggtttttcctttgcttctgtttgggtccacctggtgctagaatctt |
979024 |
T |
|
| Q |
218 |
ttatctcctgggttgttatatgtgtttctttctttcagttgtactctacaagaattattgatttctttatcagagcgtattcaccttttctttttctatg |
317 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| || |
|
|
| T |
979023 |
ttatctcctgggttcttatatgtgtctctttctttcagttgtactctacaagaattattgatttctttatcataatgtattcaccttttctttttctctg |
978924 |
T |
|
| Q |
318 |
tgcttttgtctgttaccctacataaac---cttggtttcttctagatttcatctttctctatattcttctctct |
388 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
978923 |
tgcttttgtctgttaccctacagaaaccttcttggtttcttctagatttcatttttctctatattcttctctct |
978850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University