View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5995_low_13 (Length: 242)
Name: NF5995_low_13
Description: NF5995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5995_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 17 - 240
Target Start/End: Original strand, 40184914 - 40185136
Alignment:
| Q |
17 |
atatttaaagtatcaatagggttaggtctaaccatgcacaagtgttcagagatattttgcgggggaatttcgggcatccgattttgataannnnnnnnna |
116 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
40184914 |
atatttaaagtatcaatagggttaagtctaaccatgcacaagtgttcagagaaattttgcgggggaatttcgggcatccgattttgataacttttttt-a |
40185012 |
T |
|
| Q |
117 |
atatatttgctatattgttaaatttgcattgtccgatttcaattaaagagtctaaaatgcatgactgcgagattgcgtcgttttcagaatgtagggaaac |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40185013 |
atatatttgctatattgttaaatttgcattgtccgatttcaattaaagagtctaaaatgcatgactgcgtgattgcgtcgttttcagaatgtagggaaac |
40185112 |
T |
|
| Q |
217 |
cgggttgcaaacatagccagtact |
240 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
40185113 |
cgggttgcaaacatagccagtact |
40185136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University