View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5995_low_14 (Length: 240)
Name: NF5995_low_14
Description: NF5995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5995_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 119; Significance: 6e-61; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 89 - 223
Target Start/End: Original strand, 22343792 - 22343926
Alignment:
| Q |
89 |
caatacataccatctgaagttcttgatgcattcatgttgatgccaaaatggggtggactagacaaagatttttgggctatttgcaacagtgcaagacgcc |
188 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22343792 |
caatacataccgtctgaaactcttgatgcattcatgttgatgccaaaatggggtggactagacaaagatttttgggctatttgcaacagtgcaagacgcc |
22343891 |
T |
|
| Q |
189 |
ttctctgcaattcaaagatccggtcttgttcttcg |
223 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
22343892 |
ttctctgcaattcaaagattcggtcttgttcttcg |
22343926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 21367734 - 21367774
Alignment:
| Q |
1 |
tgtcataagctgttttcattagttctcccaaatagccccac |
41 |
Q |
| |
|
||||||||||||||||||| |||||||||||| || ||||| |
|
|
| T |
21367734 |
tgtcataagctgttttcataagttctcccaaacagtcccac |
21367774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 3 - 35
Target Start/End: Complemental strand, 42545399 - 42545367
Alignment:
| Q |
3 |
tcataagctgttttcattagttctcccaaatag |
35 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
42545399 |
tcataagctgttttcatgagttctcccaaatag |
42545367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 2 - 32
Target Start/End: Complemental strand, 42215309 - 42215279
Alignment:
| Q |
2 |
gtcataagctgttttcattagttctcccaaa |
32 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
42215309 |
gtcataagctgttttcattagttctcccaaa |
42215279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 35
Target Start/End: Original strand, 22030270 - 22030304
Alignment:
| Q |
1 |
tgtcataagctgttttcattagttctcccaaatag |
35 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
22030270 |
tgtcataagctgttttcataagttctcccaaatag |
22030304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 499735 - 499699
Alignment:
| Q |
1 |
tgtcataagctgttttcattagttctcccaaatagcc |
37 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
499735 |
tgtcataagctgttttcataagttctcccaaacagcc |
499699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University