View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5996_high_15 (Length: 231)
Name: NF5996_high_15
Description: NF5996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5996_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 18 - 217
Target Start/End: Complemental strand, 39908546 - 39908346
Alignment:
| Q |
18 |
atgtgtttgtttcacaccttgaaataaagaagaaaacaattaggaacaaaacacctatgnnnnnnntcaacggcatgagatcttgttccctatttttt-g |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| | |
|
|
| T |
39908546 |
atgtgtttgtttcacaccttgaaataaagaagaaaacaattaggaacaaaacacctatgaaaaaaatcaacggcatgagatcttgttccctatttttttg |
39908447 |
T |
 |
| Q |
117 |
ttatacaggttggtctctaacaatttgattatatactaatcgcaattagttgctaagcacaaccaatagtgtaggcttgataccaaacaactagcccttt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39908446 |
ttatacaggttggtctctaacaatttgattatatactaatcacaattagttgctaagcacaaccaatagtgtaggcttgataccaaacaactagcccttt |
39908347 |
T |
 |
| Q |
217 |
g |
217 |
Q |
| |
|
| |
|
|
| T |
39908346 |
g |
39908346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University