View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5996_low_10 (Length: 310)
Name: NF5996_low_10
Description: NF5996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5996_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 16 - 297
Target Start/End: Complemental strand, 9973922 - 9973637
Alignment:
| Q |
16 |
atttccataattttcgaaattagaaacaaaatatgttccccaagctttttctagtggcttcgtatctttttgagaaaattttctaagcaaccattcttcg |
115 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9973922 |
atttccataattttcaaaattagaaacaaaatatgttccccaagctttttgtagtagcttcgtatctttttgagaaaattttctaagcaaccacccttcg |
9973823 |
T |
 |
| Q |
116 |
acgtgctt-attaaacccgcttcggaaacacacaatgcgtccttgatttccttcaagggtccttc---cctgttgcctccaattctgcccttcttctttc |
211 |
Q |
| |
|
|| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| | || |||||||||||| |
|
|
| T |
9973822 |
acatgcttcattaaacccgcttcggaaacacacaatgcgtccttgatttccttcaagggtccttcttccctgttgcctccaaatatgtccttcttctttc |
9973723 |
T |
 |
| Q |
212 |
aaaatggcacactttcggtgcttgaactccatgcaaccttgttcattgtatcctcaatgaaaggcacaatttttccacaaacatat |
297 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
9973722 |
aacatggcacactttcggtgcttgaactccatgcaaccttgttcattgtatcctcattgtaaggcacaatttttccacaaacatat |
9973637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 71; Significance: 4e-32; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 27 - 242
Target Start/End: Complemental strand, 39069914 - 39069694
Alignment:
| Q |
27 |
tttcgaaattagaaacaaaatatgttccccaagctttttctagtggcttcgtatctttttgagaaaattttctaagcaaccattcttcgacgtgctt-at |
125 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||| ||||| || || |||| |||||||||||||||||| | || ||| |||| || ||||| | |
|
|
| T |
39069914 |
tttctaaattagaaacaaactatgttccccaagcttttgctagtcgcctcatatccttttgagaaaattttctaggaaaacatccttccacatgcttcaa |
39069815 |
T |
 |
| Q |
126 |
taaacccgcttcggaaacacacaatgcgtccttgatttccttcaagggtc---cttccct-gttgcctccaattctgcccttcttctttcaaaatggcac |
221 |
Q |
| |
|
||| |||||||| |||||||| || ||||||||||||||||| ||| ||||||| || | |||||||| ||||||||||||||| ||||||| |
|
|
| T |
39069814 |
ccaactcgcttcgggtacacacaacgcatccttgatttccttcaaaagtccctcttccctagtctcttccaattccacccttcttctttcaacatggcac |
39069715 |
T |
 |
| Q |
222 |
actttcggtgcttgaactcca |
242 |
Q |
| |
|
| ||||||||||||||||||| |
|
|
| T |
39069714 |
attttcggtgcttgaactcca |
39069694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University