View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5996_low_12 (Length: 268)
Name: NF5996_low_12
Description: NF5996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5996_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 131; Significance: 5e-68; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 104 - 265
Target Start/End: Original strand, 36974460 - 36974630
Alignment:
| Q |
104 |
aaataatgcaagcctggataccagtatataattccaaatatgataatgta---------ttactcttattgtgtcatcattcacagcaactgtggcatga |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36974460 |
aaataatgcaagcctggataccagtatataattccaaatatgataatgttgaaaaatacttactcttattgtgtcatcattcacagcaactgtggcatga |
36974559 |
T |
|
| Q |
195 |
caccttatgaccataaatgaatgtttgaactttggaatcactatatgtgacgaacaatatagcatgtgact |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
36974560 |
caccttatgaccataaatgaatgtttgaactttggaatcactatatgtgacaaacaatatagcatgtgact |
36974630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 55 - 97
Target Start/End: Original strand, 36974384 - 36974426
Alignment:
| Q |
55 |
tctaatatatcttttacaaccgcaaaacatgaaaccataatat |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36974384 |
tctaatatatcttttacaaccgcaaaacatgaaaccataatat |
36974426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University