View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5996_low_14 (Length: 246)
Name: NF5996_low_14
Description: NF5996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5996_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 16 - 231
Target Start/End: Original strand, 36974618 - 36974833
Alignment:
| Q |
16 |
atagcatgggacttagtgcaaaatgacaatttggggttgcagggatacagagagaatctaactaaattataacacatctcgtgcttgaagattcaaccta |
115 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36974618 |
atagcatgtgacttagtgctaaatgacaatttggggttgcagggatacagagagaatctaactaaattataacacatctcgtgcttgaagcttcaaccta |
36974717 |
T |
 |
| Q |
116 |
acccgacacaccaagtggaacaccaccttttctatttgtacacttacttttgaacgtggcttttcctatctttgttaagttttttattttcaaatttcct |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| |
|
|
| T |
36974718 |
acccgacacaccaagtggaacaccaccttttctatttgtacacttacttttgaacgtggcttttcctatttttgttaagttttttattttcaaattgcct |
36974817 |
T |
 |
| Q |
216 |
catatagttgatgatg |
231 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
36974818 |
catatagttgatgatg |
36974833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University