View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5996_low_15 (Length: 240)
Name: NF5996_low_15
Description: NF5996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5996_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 40360172 - 40360397
Alignment:
| Q |
1 |
caacaatctgaggtacctatttgaaacaaagaacaatgttagtctttagatgggagtttggttttatcgaatatttattgtgactgcaataattgcggtt |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40360172 |
caacaatctcaggtacctatttgaaacaaggaacaatgttagtctttagatgggagtttggttttatcgaatatttattgtgactgcaataattgcggtt |
40360271 |
T |
 |
| Q |
101 |
gtggattgcaatttaaaacaagattttaatagaaag----ttgattacctcgtttgagatttttgttttccttgctgcaacactttgaacaacactgtca |
196 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40360272 |
gtggattgcaatttaaaacaatattttaagagaaagttaattgattacctcgtttgagatttttgttttccttgctgcaacactttgaacaacactgtca |
40360371 |
T |
 |
| Q |
197 |
gcactacgtgatttttggtgcatgac |
222 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
40360372 |
gcactacgtgatttttggtgcatgac |
40360397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University