View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5997_high_12 (Length: 249)
Name: NF5997_high_12
Description: NF5997
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5997_high_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 14 - 226
Target Start/End: Complemental strand, 33120919 - 33120705
Alignment:
| Q |
14 |
agaggcctaaatgttgtgttttagtgatgaccaggccttcaaaaggtgaactatctcaagatgtacaataaaacaatagagaaaaagatgaatgtgcgtt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33120919 |
agaggcctaaatgttgtgttttagtgatgaccaggcctttaaaaggtgaactatctcaagatgtacaagaaaacaatagagaaaaagatgaatgtgcgtt |
33120820 |
T |
|
| Q |
114 |
tgagatgataatattgataaaatgaattatactaaccatcacttctttagaatttaaaagag--ctcggcggttggctatcattctgccaatattgtcct |
211 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||| | |
|
|
| T |
33120819 |
tgagatgataatattgacggaatgaattatactaaccatcacttctttagaatttaaaagagtactcggcggttggctatcattctgtcaatattgtcat |
33120720 |
T |
|
| Q |
212 |
ctcaaacaaacaatt |
226 |
Q |
| |
|
|||||||| |||||| |
|
|
| T |
33120719 |
ctcaaacacacaatt |
33120705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 25 - 81
Target Start/End: Complemental strand, 45933881 - 45933825
Alignment:
| Q |
25 |
tgttgtgttttagtgatgaccaggccttcaaaaggtgaactatctcaagatgtacaa |
81 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
45933881 |
tgttgtgttttagtgatgaccaagccttcaaagggtgaactatctcaagaggtacaa |
45933825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University