View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5997_high_14 (Length: 230)
Name: NF5997_high_14
Description: NF5997
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5997_high_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 6 - 214
Target Start/End: Original strand, 41909414 - 41909622
Alignment:
| Q |
6 |
atgtcgaagaatatttatagaattggccttctccatagtatgtgtgtaatatatatcatattgatatctgtattggtttagataatcttctacaacgtcc |
105 |
Q |
| |
|
||||| || |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41909414 |
atgtctaaaaatatttatagacttggccttctccatagtatgtgtgtaatatatatcatattgatatctgtatgggtttagataatcttctacaacgtcc |
41909513 |
T |
|
| Q |
106 |
tttcaannnnnnnnnnnnnnnaaaactattagttttactatgaaaattgattttgctatttactgctatgatgatgttgcatcaattatgtctggacata |
205 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41909514 |
tttcaattttttattttttttaaaactattagttttactatgaaaattgattttgctatttactgctatgatgatgttgcatcaattatgtctggacata |
41909613 |
T |
|
| Q |
206 |
tgaagtttt |
214 |
Q |
| |
|
||||||||| |
|
|
| T |
41909614 |
tgaagtttt |
41909622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 45; Significance: 9e-17; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 166 - 214
Target Start/End: Original strand, 6846071 - 6846119
Alignment:
| Q |
166 |
tactgctatgatgatgttgcatcaattatgtctggacatatgaagtttt |
214 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6846071 |
tactgctatgatgatgttgcaccaattatgtctggacatatgaagtttt |
6846119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 168 - 214
Target Start/End: Complemental strand, 3790283 - 3790237
Alignment:
| Q |
168 |
ctgctatgatgatgttgcatcaattatgtctggacatatgaagtttt |
214 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3790283 |
ctgctataataatgttgcatcaattatgtctggacatatgaagtttt |
3790237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University