View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5997_low_10 (Length: 261)
Name: NF5997_low_10
Description: NF5997
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5997_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 18 - 252
Target Start/End: Original strand, 37451874 - 37452108
Alignment:
| Q |
18 |
gtatctagggtttgaattttaatccccacacatattatgcaattttcctataagctcacatagactctatcactccgaactttacaggtaagtaaaatga |
117 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
37451874 |
gtatctaggatttgaattttaatccccacacatattatgcaattttcctataagctcacatagactctatcactccgaactttaccggtaagtaatatga |
37451973 |
T |
 |
| Q |
118 |
tttccnnnnnnnggttgaatatatgatttccttttaacttcctaataattgcaagttcatgcattgaatttgaaaccatgttagcagctatggtagggtc |
217 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37451974 |
tttcctttttttggttgaatatatgatttccttttaacttcctaataattgcaagttcatgcattgaatttgaaaccatgctagcagctatggtagggtc |
37452073 |
T |
 |
| Q |
218 |
tccactctctatattgtgcatcgtgagagaataat |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
37452074 |
tccactctctatattgtgcatcgtgagagaataat |
37452108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University