View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5997_low_15 (Length: 226)
Name: NF5997_low_15
Description: NF5997
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5997_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 21 - 168
Target Start/End: Complemental strand, 53129239 - 53129092
Alignment:
| Q |
21 |
gaaccgctggttctattcggttttccggtctgttcaccatttttggacagagctattttaagaccagataggaccggatgcaggttcggtttttggtcca |
120 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
53129239 |
gaaccgccggttctattcggttttccggtctgttcaccatttttggacagagctattttaagaccagattggaccggatgcaggttcggtttttggtcca |
53129140 |
T |
 |
| Q |
121 |
accgattaaaccggaaggtccggtctagttttaattacttgataatac |
168 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53129139 |
accgattaaatcggaaggtccggtctagttttaattacttgataatac |
53129092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University