View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5997_low_6 (Length: 338)
Name: NF5997_low_6
Description: NF5997
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5997_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 11 - 322
Target Start/End: Complemental strand, 10163191 - 10162880
Alignment:
| Q |
11 |
cacagatacatgtttacacatctatatttgtccctattcagaatggtcatcctttagatgaagaactacagttaacttcgggcattgttcctggtaggca |
110 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10163191 |
cacagatacttgtttacacatctatatttgtccttattcagaatggtcatcctttagatgaagaactacagttaactttgggcattgttcctggtaggca |
10163092 |
T |
 |
| Q |
111 |
ggctcagatgcgaggttggaacttgcaaatatgcaaccaagagcaagtgctgtagacgttatccgttttagcgcatctattacacctagcaattcaagtg |
210 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
10163091 |
gactcagatgcgaggttggaacttgcaaatatgcaaccaagagcaagtgctgtagacgttatccgttttagcgcatctagtacacctagcaattcaagtg |
10162992 |
T |
 |
| Q |
211 |
gaggatctgaagcagatgatattgagtcaaaaggtgatgtttacatatggggagaggtttttgcagatggatttccttcaaagacagatgtgttgacccc |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10162991 |
gaggatctgaagcagatgatattgagtcaaaaggtgatgtttacatatggggagaggtttttgcagatggatttccttcaaagacagatgtgttgacccc |
10162892 |
T |
 |
| Q |
311 |
tatgctgttaga |
322 |
Q |
| |
|
|| ||||||||| |
|
|
| T |
10162891 |
taggctgttaga |
10162880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University