View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5998_low_9 (Length: 201)
Name: NF5998_low_9
Description: NF5998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5998_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 16 - 187
Target Start/End: Complemental strand, 43568828 - 43568657
Alignment:
| Q |
16 |
caaagccaagaacagcaatgggtcctggcggtatgattggcgggagggttgcgaagacgtcgaagtaagtgtctgtttgggtttttaaaaggaaagaaat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| || ||||| ||||| |
|
|
| T |
43568828 |
caaagccaagaacagcaatgggtcctggcggtatgattggcgggagtgttgcgaagacgtcgaagtaagtgtctgttagggttttgaataggaaggaaat |
43568729 |
T |
 |
| Q |
116 |
gctgtggatgtttccaggattatcaaggaggagaaggcgggaaccgcggaatgggtggtcggcttttctaga |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43568728 |
gctgtggatgtttccaggattatcaaggaggagaaggcgggaaccgcggaatgggtggtcggcttttctaga |
43568657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University