View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5999_high_37 (Length: 299)
Name: NF5999_high_37
Description: NF5999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5999_high_37 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 9 - 282
Target Start/End: Complemental strand, 3009046 - 3008773
Alignment:
| Q |
9 |
tatccaacaaaaggggccatatgagatttccttcccttctgtattcttggcaaaatgttgctcctttcttcttagcatccattactaacccttcaataaa |
108 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3009046 |
tatccaacaaaagtggccatatgagatttccttcccttctgtattcttggcaaaatgttgctcctttcttcttagcatccattactaacccttcaataaa |
3008947 |
T |
|
| Q |
109 |
gttagcagaggattctgtgatgaccggtgtgatgtcgcagtcatcctcaggaggaccgacagttaatttggccactttatctttgattttctttacaagt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3008946 |
gttagcagaggattctgtgatgaccggtgtgatgtcgcagtcatcctcaggaggaccgacagttaatttggccactttatctttgattttctttacaagt |
3008847 |
T |
|
| Q |
209 |
gtctcagctaccgattccatgaccaaagcaacctttactgccgtgcatctttgaccactgacatatcaaaacat |
282 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3008846 |
gtctcagcaaccgattccatgaccaaagcaacctttactgccgtgcatctttgaccactgacatatcaaaacat |
3008773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 23 - 159
Target Start/End: Original strand, 54725311 - 54725447
Alignment:
| Q |
23 |
ggccatatgagatttccttcccttctgtattcttggcaaaatgttgctcctttcttcttagcatccattactaacccttcaataaagttagcagaggatt |
122 |
Q |
| |
|
||||| || ||||| ||||| || ||||||||||||| |||||||||||||||| ||||||||| | || || |||||||| || ||||| || |||| |
|
|
| T |
54725311 |
ggccaaataagattcccttctctcttgtattcttggcagaatgttgctcctttctgcttagcatcattcaccaagccttcaatgaaattagctgatgatt |
54725410 |
T |
|
| Q |
123 |
ctgtgatgaccggtgtgatgtcgcagtcatcctcagg |
159 |
Q |
| |
|
||| | || || ||||| || |||||||||||||| |
|
|
| T |
54725411 |
ctgatacaactggggtgatatcacagtcatcctcagg |
54725447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University